Home
Genetics home
Genetics syllabus
Last Modified on 8/29/05
wmitchel@ramapo.edu

Laboratory Reports

Your laboratory report grades can make the difference between one letter grade and the next. I am accepting your TWO best lab reports which I will grade thoroughly. Since you can hand in more than two reports, you can perfect your writing during the duration of the semester.

Laboratory reports are not written in the style of popular literature, or a review article -- they are written to convey complex information in a direct, unambiguous way. If you read a scientific paper based on original research, you will be struck by the number of short, simple, declarative statements which are intended to convey complex information in a way which will not be misunderstood.

If you feel you must ask a question in your report reword it into a statement. Use past tense when writing since everything that you write about has already occurred. When a scientific term exists use it in place of a colloquial term or scientific jargon. When in doubt use numbers to describe things. Assume your reader knows very little about the work that you did, since you will never know the backgrounds of the people that want to read about your work.

Parts of the Paper

I) The TITLE and your name

II) ABSTRACT - Describe the results and significance of the laboratory in 300 words or less.

III) INTRODUCTION - What is the biological problem that you researched, and why is this problem important? This should be brief.

IV) MATERIALS AND METHODS - What living things, chemical reagents, apparatus, and techniques did you use? Do Not make lists of materials and/or methods, but Do write this section in Paragraph Form. Do Not write about every detail, but Do write enough so that the reader can understand what you did.

Briefly answer the question; What techniques did I use? For instance say "I precipitated protein by adding solid ammonium acetate to make the solution 250 mM in acetate." rather than "We measured the volume of our solution and added XYZ g of solid ammonium acetate as referenced in Table 31 'precipitation of proteins with ammonium sulfate' of Dr. Doolittle's Book of Tables for Protein Chemistry (5)." Notice that the important thing about the above example is that the procedure "...by adding solid ammonium acetate to make the solution 250 mM in acetate." and the purpose of the procedure "I precipitated protein..." were both included.

V) RESULTS (What data was generated from the experiment(s) or what are THE FACTS) - No part of your report is as important as YOUR DATA! I WILL BE PICKY IN THIS SECTION! All figures and tables are referred to in this section. All mention of measured or calculated values should have units unless unitless. This is the only section which can contain tables and graphs. I will be especially diligent in this section! Below is a checklist.

___Figures are pictures, diagrams or graphs. Tables list alphanumeric data in rows and columns. Tables and Figures are not the same thing!

___Metric Units will be used in figures, tables and the text.

___All tables and figures will be cited in the text of the results section and numbered in the order in which they are discussed. For example... Table 1 shows the results of the Bradford protein assay of the liver tissue extracts, and table 2 shows the molecular weights of the more abundant proteins of these extracts.

___Each figure should be labeled with a title and number below the figure and a figure legend in the figure.

___You will draw all graphs (figures) by hand to show me that you understand how to make a graph.

___Every graph axis will be labeled.

___Each table should be labeled with a title, and number above the data in the table.

___Each table column and row will be labeled.

___Every graph axis should be linear unless labeled as nonlinear.

___Every graph axis should be divided into labeled units.

___No data analysis is allowed in this section!

Examples of figures and Tables

vege1 ATGCATGCATGCATGCATGCATGCATTTCGGC

lubdub1 ATGCATGCGAGAGAGCATGCATGCATGCATGC

Figure 1. Sequence comparison of celery heart cDNA clone vege1 and human myocardium cDNA clone lubdub1. Regions of homology between the two sequences are underlined.


Fig. 3. Quality of DNA from Gnomes as a Function of Age.

 

Table 4. Leaf number as a function of age and height in A. vulgaris.

VI) Discussion (Conclusion) - This is the place for you to analyze (contemplate) what your data means. What did the experiments ultimately show? Analyze your data whether you expected the results you obtained or not. Do Not restate the data but Do explain what you believe the data means. This is the final statement concerning the experiment(s) performed and analyzed, and you will explain the significance of the work! For example... The data from the mutagen experiment shows that UV light is a more effective mutagen than an equal amount of visible light. A discussion and a conclusion are the same thing (don't have both).

VII) Citations (Works Cited) - List all written works that helped you to write the report. For your reports, there should be very few of these. Cite the works in the body of the report. I will except any format for citations as long as they are complete [author(s), Title, Source, Year, Publisher].

Technical points

All the major parts of the paper [Intro., Mater. & Methods, Results, Discussion and Citations] will have a labeled heading.

Assume the reader of your paper is unfamiliar with the subject and must be introduced to the basic research problem and methodology of the paper. [If you were to give your report to an intelligent person and have them read it, would they be able to "follow along" or would they be "lost"? You may be amused that this writing problem is common among scientists who assume "Everyone knows this already".]

When in doubt, use a scientific term instead of a common English term.

Remove all questions from your report, or reword them as declarative statements.

All adjectives which have vague meanings Will Not be used in the report.

Slang and jargon (professional slang) Will Not be used in the report.

Abbreviations Will Not be used Unless they are commonly used in biology, such as oC, hr, min, kg, KD, bp, OD, etc.

The report should be long enough to explain the purpose, methods, data and analysis of the experiment(s), approximately 3 to 5 pages of 12 point double spaced text not counting figures and tables.